ID: 1091220749_1091220758

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1091220749 1091220758
Species Human (GRCh38) Human (GRCh38)
Location 11:133928640-133928662 11:133928673-133928695
Sequence CCCCCGGGGCAGGGCAGGTGGCT CTCAAACAGGAGTGTAGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 55, 4: 485} {0: 1, 1: 0, 2: 2, 3: 10, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!