ID: 1091283163_1091283172

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1091283163 1091283172
Species Human (GRCh38) Human (GRCh38)
Location 11:134393814-134393836 11:134393866-134393888
Sequence CCTGCTGGTTAAGACAGCTGCTG CAGTGCCCCCAAAGAGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 140} {0: 1, 1: 0, 2: 0, 3: 22, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!