ID: 1091391984_1091392003

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1091391984 1091392003
Species Human (GRCh38) Human (GRCh38)
Location 12:131333-131355 12:131381-131403
Sequence CCCAGAGACCCCCCACTCCCTGG TCTGCTCTCTGACCTGGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 363} {0: 1, 1: 0, 2: 1, 3: 41, 4: 358}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!