ID: 1091405954_1091405963

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1091405954 1091405963
Species Human (GRCh38) Human (GRCh38)
Location 12:209727-209749 12:209777-209799
Sequence CCAGCACACAGCTCTCCCCACCA TCCGTTTTTGTAGCAGAGATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 63, 4: 437} {0: 1, 1: 0, 2: 2, 3: 126, 4: 5699}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!