ID: 1091407166_1091407168

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1091407166 1091407168
Species Human (GRCh38) Human (GRCh38)
Location 12:216291-216313 12:216306-216328
Sequence CCTCACTCAAGTTCTCCTAGCCT CCTAGCCTCCAAGACCCACTTGG
Strand - +
Off-target summary {0: 6, 1: 1, 2: 1, 3: 15, 4: 169} {0: 7, 1: 0, 2: 1, 3: 11, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!