ID: 1091474035_1091474048

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1091474035 1091474048
Species Human (GRCh38) Human (GRCh38)
Location 12:753945-753967 12:753982-754004
Sequence CCACCGCCACTTCCCAGGTAGCC CGCTGCCGCCCCTGGGGAACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 44, 4: 502} {0: 1, 1: 0, 2: 0, 3: 16, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!