ID: 1091481637_1091481647

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1091481637 1091481647
Species Human (GRCh38) Human (GRCh38)
Location 12:838505-838527 12:838554-838576
Sequence CCTGGGCTCAAGTGATTCTCCCG ATGGACACACACCACCATGCTGG
Strand - +
Off-target summary {0: 110, 1: 4531, 2: 64130, 3: 172090, 4: 262634} {0: 1, 1: 0, 2: 7, 3: 128, 4: 534}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!