ID: 1091481639_1091481647

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1091481639 1091481647
Species Human (GRCh38) Human (GRCh38)
Location 12:838525-838547 12:838554-838576
Sequence CCGCCTCAGCCTCCTGAGTATCT ATGGACACACACCACCATGCTGG
Strand - +
Off-target summary {0: 298, 1: 14230, 2: 28713, 3: 41536, 4: 38218} {0: 1, 1: 0, 2: 7, 3: 128, 4: 534}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!