ID: 1091481645_1091481647

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1091481645 1091481647
Species Human (GRCh38) Human (GRCh38)
Location 12:838537-838559 12:838554-838576
Sequence CCTGAGTATCTGGGACCATGGAC ATGGACACACACCACCATGCTGG
Strand - +
Off-target summary {0: 2, 1: 5, 2: 131, 3: 1937, 4: 19706} {0: 1, 1: 0, 2: 7, 3: 128, 4: 534}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!