ID: 1091495480_1091495483

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1091495480 1091495483
Species Human (GRCh38) Human (GRCh38)
Location 12:968709-968731 12:968742-968764
Sequence CCACAAAGCAGCATATGCATAGG TGCCCAGCAAAGATCTGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 136} {0: 1, 1: 3, 2: 12, 3: 67, 4: 289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!