ID: 1091526918_1091526923

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1091526918 1091526923
Species Human (GRCh38) Human (GRCh38)
Location 12:1312000-1312022 12:1312031-1312053
Sequence CCATTTTTCCTCAAGAACATGAT TTGCATCTCAGTGCAGGGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 351} {0: 1, 1: 0, 2: 1, 3: 18, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!