ID: 1091544563_1091544567

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1091544563 1091544567
Species Human (GRCh38) Human (GRCh38)
Location 12:1492845-1492867 12:1492872-1492894
Sequence CCCACTCCCATCACACTAGGACT ATTCCATGCCCCTCTCCTAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 257} {0: 1, 1: 0, 2: 1, 3: 10, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!