ID: 1091551579_1091551587

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1091551579 1091551587
Species Human (GRCh38) Human (GRCh38)
Location 12:1539131-1539153 12:1539159-1539181
Sequence CCAAAAATGTCTCTGGACATTGC GTCCCGTGGGGAGAGCGGGAGGG
Strand - +
Off-target summary {0: 10, 1: 71, 2: 408, 3: 869, 4: 1323} {0: 1, 1: 0, 2: 0, 3: 11, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!