ID: 1091558682_1091558698

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1091558682 1091558698
Species Human (GRCh38) Human (GRCh38)
Location 12:1594456-1594478 12:1594485-1594507
Sequence CCTCCGCCTCCTGCCGCCGCCGC GCGGGCCGGCGGGCGGCGAGGGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 66, 3: 331, 4: 1603} {0: 1, 1: 0, 2: 14, 3: 103, 4: 733}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!