ID: 1091558685_1091558712

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1091558685 1091558712
Species Human (GRCh38) Human (GRCh38)
Location 12:1594465-1594487 12:1594514-1594536
Sequence CCTGCCGCCGCCGCTGCTCCGCG GGGGCCGGGCGCACGGGCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 87, 4: 563} {0: 1, 1: 0, 2: 12, 3: 168, 4: 899}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!