ID: 1091558690_1091558701

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1091558690 1091558701
Species Human (GRCh38) Human (GRCh38)
Location 12:1594472-1594494 12:1594492-1594514
Sequence CCGCCGCTGCTCCGCGGGCCGGC GGCGGGCGGCGAGGGGGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 208} {0: 1, 1: 0, 2: 11, 3: 109, 4: 939}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!