ID: 1091582322_1091582344

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1091582322 1091582344
Species Human (GRCh38) Human (GRCh38)
Location 12:1797301-1797323 12:1797350-1797372
Sequence CCCCTCCTCCCGGCTGTGGAGCC CCGCACTTCCGCCTTGCCGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 288} {0: 1, 1: 0, 2: 0, 3: 3, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!