ID: 1091582813_1091582820

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1091582813 1091582820
Species Human (GRCh38) Human (GRCh38)
Location 12:1799291-1799313 12:1799307-1799329
Sequence CCTGGGGCCCCTGGAACCCGGAG CCCGGAGTCCCGCTGAGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 297} {0: 1, 1: 0, 2: 0, 3: 9, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!