ID: 1091584580_1091584591

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1091584580 1091584591
Species Human (GRCh38) Human (GRCh38)
Location 12:1808863-1808885 12:1808905-1808927
Sequence CCGGTGCTCTGTCTGGGGAGGAG CATGAAAGGGAGAAGGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 41, 4: 333} {0: 1, 1: 0, 2: 9, 3: 120, 4: 967}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!