ID: 1091596949_1091596953

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1091596949 1091596953
Species Human (GRCh38) Human (GRCh38)
Location 12:1884716-1884738 12:1884740-1884762
Sequence CCATGGCAGCAGGAGAAGCTTTT TCTCCCTGGACACCCGTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 222} {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!