ID: 1091606282_1091606285

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1091606282 1091606285
Species Human (GRCh38) Human (GRCh38)
Location 12:1954676-1954698 12:1954691-1954713
Sequence CCCAGTCTACAGTGCTAGCTCTG TAGCTCTGCATCTGGCACAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 182} {0: 1, 1: 0, 2: 7, 3: 26, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!