ID: 1091610886_1091610890

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1091610886 1091610890
Species Human (GRCh38) Human (GRCh38)
Location 12:2007766-2007788 12:2007787-2007809
Sequence CCTTTGCCCATCTGTCTTCTTAG AGCTTGGAATGACCTTTTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 311} {0: 1, 1: 0, 2: 0, 3: 18, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!