ID: 1091682508_1091682518

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1091682508 1091682518
Species Human (GRCh38) Human (GRCh38)
Location 12:2537141-2537163 12:2537193-2537215
Sequence CCTCCTCCACTTAGTGATGCCAG CTCCCATGACAGATAGGAAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 11, 4: 123} {0: 1, 1: 0, 2: 0, 3: 18, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!