ID: 1091686530_1091686537

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1091686530 1091686537
Species Human (GRCh38) Human (GRCh38)
Location 12:2566632-2566654 12:2566653-2566675
Sequence CCAAGGCCCAGGGGAGGGCATAA AACCACAGGCAGAAGGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 23, 4: 231} {0: 1, 1: 1, 2: 4, 3: 37, 4: 438}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!