ID: 1091690247_1091690252

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1091690247 1091690252
Species Human (GRCh38) Human (GRCh38)
Location 12:2591337-2591359 12:2591363-2591385
Sequence CCCTTCACCTTCATCTTATACAG CCCCTTCCTTCTGACCGGTGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 25, 4: 248} {0: 1, 1: 0, 2: 3, 3: 11, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!