ID: 1091691927_1091691931

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1091691927 1091691931
Species Human (GRCh38) Human (GRCh38)
Location 12:2603143-2603165 12:2603173-2603195
Sequence CCAGATTTGAATCCCAGCATGGC TCACTATTTAACCTTGAATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 313} {0: 1, 1: 0, 2: 2, 3: 10, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!