ID: 1091696311_1091696316

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1091696311 1091696316
Species Human (GRCh38) Human (GRCh38)
Location 12:2630482-2630504 12:2630500-2630522
Sequence CCAAGTGGGAGGAAGGGGCTGTT CTGTTGAAATAGTGGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 274} {0: 1, 1: 0, 2: 1, 3: 19, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!