ID: 1091696330_1091696347

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1091696330 1091696347
Species Human (GRCh38) Human (GRCh38)
Location 12:2630561-2630583 12:2630614-2630636
Sequence CCTGAAATTGTCTTCATGGTCCA AGGCAGGACGGTGGGAGGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 143} {0: 1, 1: 0, 2: 2, 3: 44, 4: 657}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!