ID: 1091699684_1091699689

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1091699684 1091699689
Species Human (GRCh38) Human (GRCh38)
Location 12:2651451-2651473 12:2651480-2651502
Sequence CCATGGGGCTGGGCTGTCCACTC GTGGGCGGCCGCCCTCCCATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 387} {0: 1, 1: 0, 2: 1, 3: 15, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!