ID: 1091705962_1091705976

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1091705962 1091705976
Species Human (GRCh38) Human (GRCh38)
Location 12:2693551-2693573 12:2693593-2693615
Sequence CCTTCCTCACTCTGGAGCAGCCT ATGTTTGGGCTGCCGGGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 362} {0: 1, 1: 0, 2: 0, 3: 16, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!