ID: 1091723985_1091723993

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1091723985 1091723993
Species Human (GRCh38) Human (GRCh38)
Location 12:2833196-2833218 12:2833235-2833257
Sequence CCACTCCGGGATGGCAATGTCAG GGGGCCAAACACATGTAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 71} {0: 1, 1: 0, 2: 1, 3: 10, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!