ID: 1091745115_1091745124

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1091745115 1091745124
Species Human (GRCh38) Human (GRCh38)
Location 12:2987026-2987048 12:2987065-2987087
Sequence CCTGAGAGAGAGCCGAGGAGGTG CAAGCTGAACACTTGGTTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 265} {0: 1, 1: 0, 2: 1, 3: 16, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!