ID: 1091763113_1091763121

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1091763113 1091763121
Species Human (GRCh38) Human (GRCh38)
Location 12:3100672-3100694 12:3100697-3100719
Sequence CCAGGCATCACCTCATTTCCTGG TCATCCTTCTGCACTGGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 276} {0: 1, 1: 0, 2: 3, 3: 16, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!