ID: 1091769958_1091769963

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1091769958 1091769963
Species Human (GRCh38) Human (GRCh38)
Location 12:3145103-3145125 12:3145132-3145154
Sequence CCCACTCCCTTGTGAGCACACAG CAGCAGCCCTCGGCGTCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 57, 4: 752} {0: 1, 1: 0, 2: 1, 3: 21, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!