ID: 1091785150_1091785157

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1091785150 1091785157
Species Human (GRCh38) Human (GRCh38)
Location 12:3238892-3238914 12:3238937-3238959
Sequence CCAAGCTGTTTCCTTGCTTCATG CATGCAGGCCCTCCCAAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 252} {0: 1, 1: 0, 2: 3, 3: 20, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!