ID: 1091786196_1091786209

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1091786196 1091786209
Species Human (GRCh38) Human (GRCh38)
Location 12:3244669-3244691 12:3244712-3244734
Sequence CCCCCCTAAAGGGGACCATGTGG GGTGTGAGACCCGGGTAATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 83} {0: 1, 1: 0, 2: 0, 3: 8, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!