ID: 1091866184_1091866205

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1091866184 1091866205
Species Human (GRCh38) Human (GRCh38)
Location 12:3839180-3839202 12:3839232-3839254
Sequence CCGCTCGCGGAGCCCGAGCCCCA GCGTCGAGCAGCCGGCGGCCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 10, 4: 127} {0: 2, 1: 0, 2: 1, 3: 2, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!