ID: 1091916085_1091916091

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1091916085 1091916091
Species Human (GRCh38) Human (GRCh38)
Location 12:4272621-4272643 12:4272652-4272674
Sequence CCGACCGTGCTGGCGGCGACTTC CGGCTCCCAGGGAGAAAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 25} {0: 1, 1: 0, 2: 2, 3: 18, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!