ID: 1091924573_1091924577

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1091924573 1091924577
Species Human (GRCh38) Human (GRCh38)
Location 12:4334674-4334696 12:4334715-4334737
Sequence CCTGAAGTACGTTCTTTGAAAAG GCAGCTGGTGGTAAACATAGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 130, 4: 873} {0: 1, 1: 0, 2: 1, 3: 11, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!