ID: 1091978949_1091978955

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1091978949 1091978955
Species Human (GRCh38) Human (GRCh38)
Location 12:4850269-4850291 12:4850282-4850304
Sequence CCTGACGCTGGTGCAGGCTGAGG CAGGCTGAGGGTCCGAGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 243} {0: 1, 1: 0, 2: 4, 3: 40, 4: 304}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!