ID: 1092093817_1092093822

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1092093817 1092093822
Species Human (GRCh38) Human (GRCh38)
Location 12:5825338-5825360 12:5825379-5825401
Sequence CCATGTATGCTCTGAATCACCAT TCTCCCATAGCCAGGATTCACGG
Strand - +
Off-target summary {0: 3, 1: 74, 2: 98, 3: 99, 4: 184} {0: 129, 1: 151, 2: 122, 3: 124, 4: 261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!