ID: 1092167606_1092167620

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1092167606 1092167620
Species Human (GRCh38) Human (GRCh38)
Location 12:6352597-6352619 12:6352647-6352669
Sequence CCATCCCAGTTCTGTATACCCTG TTAATTTGCTCATCTGAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 166} {0: 1, 1: 0, 2: 0, 3: 22, 4: 358}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!