ID: 1092194598_1092194604

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1092194598 1092194604
Species Human (GRCh38) Human (GRCh38)
Location 12:6541633-6541655 12:6541648-6541670
Sequence CCAACTCCAGCTGTGGTGGGGCA GTGGGGCAGGCAGGGCCATCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 204} {0: 1, 1: 1, 2: 6, 3: 75, 4: 564}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!