ID: 1092226602_1092226604

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1092226602 1092226604
Species Human (GRCh38) Human (GRCh38)
Location 12:6752358-6752380 12:6752373-6752395
Sequence CCACACTGGAAAGATATGGAAGC ATGGAAGCTCAGATACTTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 238} {0: 1, 1: 0, 2: 0, 3: 23, 4: 364}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!