ID: 1092239518_1092239536

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1092239518 1092239536
Species Human (GRCh38) Human (GRCh38)
Location 12:6828488-6828510 12:6828524-6828546
Sequence CCCGGGGTCCCCTGAGCCCCCCG GTCCCCGGGGGCGCCCCCGCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 6, 3: 49, 4: 466} {0: 1, 1: 0, 2: 2, 3: 24, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!