ID: 1092260858_1092260870

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1092260858 1092260870
Species Human (GRCh38) Human (GRCh38)
Location 12:6952643-6952665 12:6952662-6952684
Sequence CCTTGTCCCAGCCGCCCCGTGGG TGGGGATGGGTCTGTCCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 209} {0: 1, 1: 0, 2: 4, 3: 32, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!