ID: 1092282373_1092282386

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1092282373 1092282386
Species Human (GRCh38) Human (GRCh38)
Location 12:7108155-7108177 12:7108205-7108227
Sequence CCTCCAGATGGGGGATTCAGGGC CTCCCTGGCCACAGTCCTGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 128} {0: 1, 1: 1, 2: 3, 3: 53, 4: 354}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!