ID: 1092283090_1092283105

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1092283090 1092283105
Species Human (GRCh38) Human (GRCh38)
Location 12:7112203-7112225 12:7112247-7112269
Sequence CCGTTTTCCATGAAGCCAGTCCC CTGCTGGTATAGAGGACAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 232} {0: 1, 1: 0, 2: 0, 3: 13, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!