ID: 1092307267_1092307272

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1092307267 1092307272
Species Human (GRCh38) Human (GRCh38)
Location 12:7314209-7314231 12:7314260-7314282
Sequence CCATCAGTTGGAGAAAGAGCCAG GTTGGACATACAAGATTGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 194} {0: 1, 1: 0, 2: 0, 3: 7, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!