ID: 1092354686_1092354699

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1092354686 1092354699
Species Human (GRCh38) Human (GRCh38)
Location 12:7784819-7784841 12:7784846-7784868
Sequence CCCTTTTTACATTGGGTCAAAGG CTGAGGGTAGGGTGGGAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 158} {0: 1, 1: 1, 2: 12, 3: 109, 4: 1222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!